I’m a newbie who is just getting started. I’ve already completed the steps of installing and running a phylogenetic workflow., However I’m now stuck at the “Prepare the Sequences” step. The sequence I downloaded from the BLAST website after performing BLAST looks like this: “>PP746152.1 Influenza A virus (A/Wild duck/South Korea/KNU20-65/2020(H6N6)) segment 4 hemagglutinin (HA) gene, complete cds
ATGATTGCATTCATTGTAATAGCGATACTGGTAACAACCGGAAGATCAGATA…”
My original sequence looks like this: “>TSN20250428-027-00036_1_20250429-BAN54_A01_A01_i87.1
CGTATTAGTAGAAACAAGGGTGTTTTTCTCAATCATATACATATCCTGCA…”
I’m wondering if I need to manually input the sequences and the tab-delimited metadata that are required. Or have I missed some steps? The FASTA file I directly downloaded from BLAST and the tab-delimited metadata required in the example are very different, so I don’t know how to proceed.
Additionally, if possible, could I obtain a few sample “Prepare the Sequences” files, including strain ID and metadata, so that I can refer to them and modify my local files accordingly?
Best regards.
I found the Zika tutorial pathogen repository on GitHub, and it seems my questions will be resolved. I still have one more question: does the metadata need to be added manually, or do I have to name it myself in the header separated by “|”? In short, is it all done manually?
I apologize for the inconvenience. I have encountered a new issue. In the “Creating a phylogenetic workflow” section, where does the auspice_config.json file come from? Additionally, when I followed the example code in the “Identify Amino-Acid Mutations” step, I encountered an error. I suspect there might be some additional settings required, but I don’t quite understand them yet.
The latest and only issue I have now is the configuration of the auspice_config.json file. Over these past few days, I have successfully run it once. I found two example JSON files on GitHub, but I couldn’t figure out how they were generated. I’m quite puzzled and hope you can provide an example command to generate the auspice_config.json file. I have tried to generate it myself, but the results were not satisfactory. When I used aispice.us to run it, there was no animation or timeline displayed.
Hello @YAOsanmeme,
Happy to hear you have resolved your other issues. The auspice_config.json file is generated manually. We usually take an existing file (e.g. zika’s auspice_config.json) and modify it for a new build. You can find more examples on GitHub via this GitHub search.
For the timeline and animation display, you need to have a “time tree” that has temporal data inferred for ancestral nodes. This is done with augur refine as show in the Get a Time-Resolved Tree step of the tutorial.
Best,
Jover